Give the sequence of a reverse primer used to insert a BamHI site (GGATCC) at the 3′ end of the following sequence: 5′ CTGAACGTCCAAGGCTTAA 3′ 3′ GACTTGCAGGTTCCGAATT 5′ . Make sure you indicate your pr

The reverse primer sequence would be 5' AATTAGATCCTGGACGTTCAG 3' with a polarity of 5' to 3'. The BamHI site is GGATCC, which is a recognition site for the BamHI restriction enzyme. To insert it at the 3' end of the given sequence, we need to design a primer that is complementary to the template sequence starting from the 3' end and ending with the BamHI site. Starting from the 3' end of the template sequence, we have AA as the last two nucleotides. The complement of AA is TT, so we can use TT as the first two nucleotides of our reverse primer. The next four nucleotides are AGCT, which are complementary to the BamHI site (GGATCC) in reverse order. Thus, we can directly use the BamHI sequence as the next six nucleotides of our primer. Finally, we need to add a few extra nucleotides at the 5' end to ensure efficient annealing to the template, and we can choose AATT as the last four nucleotides. Therefore, the reverse primer sequence is 5' AATTAGATCCTGGACGTTCAG 3', and its polarity is 5' to 3'.